Data modeling goal:

• describe a dataset using a relatively small number of mathematical relationships, or
• use some parts of a dataset to try to accurately predict other parts of the dataset

Models:

• reflect our beliefs about the way the universe works
• can identify patterns within a dataset that are the result of causal relationships
• separate meaningful signal of interest from noise
• the model itself does not identify or even accurately reflect those causal effects
• summarizes patterns and we as scientists are left to interpret those patterns

1. Data are never wrong.
2. Not all data are useful.
3. “All models are wrong, but some are useful.” - George Box
4. Data do not contain causal information.
   • i.e. “Correlation does not mean causation.”
5. All data have noise.

• Scientific model:
  • conceptual representation of our belief of the universe
  • proposes causal explanations for phenomenon, i.e. hypotheses
  • helps us design experiments and collect data to test the accuracy of the model
• Statistical model:
  • maps a scientific model onto a mechanical procedure
  • quantifies how well our scientific model explains a dataset

The scientific model and statistical model are related but independent choices we make

• We might lack sufficient information to form a scientific model
• Must first gain knowledge by examining data
• Can then possibly generate a scientific model
• This step sometimes called exploratory data analysis (EDA)

Consider three imaginary genes measured in Parkinson’s Disease (PD) patients blood:

set.seed(1337)
gene_exp <- tibble(
  sample_name = c(str_c("P",1:100), str_c("C",1:100)),
  `Disease Status` = factor(c(rep("PD",100),rep("Control",100))),
  `Gene 1` = c(rnorm(100,255,10), rnorm(100,250,10)),
  `Gene 2` = c(rnorm(100,520,100), rnorm(100,600,60)),
  `Gene 3` = c(rnorm(100,500,40), rnorm(100,330,40))
)

gene_exp

## # A tibble: 200 × 5
##    sample_name `Disease Status` `Gene 1` `Gene 2` `Gene 3`
##    <chr>       <fct>               <dbl>    <dbl>    <dbl>
##  1 P1          PD                   257.     636.     504.
##  2 P2          PD                   241.     556.     484.
##  3 P3          PD                   252.     426.     476.
##  4 P4          PD                   271.     405.     458.
##  5 P5          PD                   248.     482.     520.
##  6 P6          PD                   275.     521.     460.
##  7 P7          PD                   264.     415.     568.
##  8 P8          PD                   276.     450.     495.
##  9 P9          PD                   274.     490.     496.
## 10 P10         PD                   251.     584.     573.
## # ℹ 190 more rows

pivot_longer(
  gene_exp,
  c(`Gene 1`, `Gene 2`, `Gene 3`),
  names_to="Gene",
  values_to="Expression"
) %>% ggplot(
    aes(x=`Disease Status`,y=Expression,fill=`Disease Status`)
  ) +
  facet_wrap(vars(Gene)) +
  geom_violin()

• Gene 1 does not look different between PD and control
• Gene 2 looks to have different means, but distributions overlap
• Gene 3 is very different in PD versus control
• Qualitative observations: We made them with our eyes
• How do we quantify these observations?

• How much higher is Gene 3 expression in PD than control?
• If I know/suspect a patient has PD, what Gene 3 expression might we expect them to have?
• If all I know about a patient is their gene expression, how likely is it that they have PD?

• We might lack sufficient information to form a scientific model
• Must first gain knowledge by examining data
• Can then possibly generate a scientific model
• This step sometimes called exploratory data analysis (EDA)

• principal component analysis (PCA): statistical procedure that reduces the effective dimensionality of a dataset while preserving variance
• One of many dimensionality reduction techniques
• Identifies so-called directions of orthogonal variance called principal components

• PCA decomposes a dataset into a set of orthonormal basis vectors (principal components)
• These principal components (PCs) collectively capture all the variance in the dataset
• First basis vector is called the first principal component and explains the largest fraction of the variance
• Second principal component explains the second largest fraction, and so on
• Always an equal number of principal components as there are dimensions in the dataset or the number of samples, whichever is smaller
• Typically only small number of PCs needed to explain most of the variance

• Each principal component is a \(p\)-dimensional unit vector:
  • \(p\) is the number of features in the dataset
  • values are weights that describe the component’s direction of variance
• Product of each component with the values in each sample, we obtain a projection
• Projections of each sample made with each principal component produces a rotation of the dataset

• Biological datasets often have many thousands of features (e.g. genes) and comparatively few samples
• Maximum number of PCs in PCA is smaller of (number of features, number of samples)
• stats::prcomp() function performs PCA in R

# intensities contains microarray expression data for ~54k probesets x 20
# samples

# transpose expression values so samples are rows
expr_mat <- intensities %>%
  pivot_longer(-c(probeset_id),names_to="sample") %>%
  pivot_wider(names_from=probeset_id)

# PCA expects all features (i.e. probesets) to be mean-centered,
# convert to dataframe so we can use rownames
expr_mat_centered <-  as.data.frame(
  lapply(dplyr::select(expr_mat,-c(sample)),function(x) x-mean(x))
)
rownames(expr_mat_centered) <- expr_mat$sample

# prcomp performs PCA
pca <- prcomp(
  expr_mat_centered,
  center=FALSE, # already centered
  scale=TRUE # prcomp scales each feature to have unit variance
)

# the str() function prints the structure of its argument
str(pca)

## List of 5
##  $ sdev    : num [1:20] 101.5 81 71.2 61.9 57.9 ...
##  $ rotation: num [1:54675, 1:20] 0.00219 0.00173 -0.00313 0.00465 0.0034 ...
##   ..- attr(*, "dimnames")=List of 2
##   .. ..$ : chr [1:54675] "X1007_s_at" "X1053_at" "X117_at" "X121_at" ...
##   .. ..$ : chr [1:20] "PC1" "PC2" "PC3" "PC4" ...
##  $ center  : logi FALSE
##  $ scale   : Named num [1:54675] 0.379 0.46 0.628 0.272 0.196 ...
##   ..- attr(*, "names")= chr [1:54675] "X1007_s_at" "X1053_at" "X117_at" "X121_at" ...
##  $ x       : num [1:20, 1:20] -67.94 186.14 6.07 -70.72 9.58 ...
##   ..- attr(*, "dimnames")=List of 2
##   .. ..$ : chr [1:20] "A1" "A2" "A3" "A4" ...
##   .. ..$ : chr [1:20] "PC1" "PC2" "PC3" "PC4" ...
##  - attr(*, "class")= chr "prcomp"

The result of prcomp() is a list with five members:

• sdev - the standard deviation (i.e. the square root of the variance) for each component
• rotation - a matrix where the principal components are in columns
• x - the projections of the original data
• center - if center=TRUE was passed, a vector of feature means
• scale - if scale=TRUE was passed, a vector of the feature variances

• Each principal component explains a fraction of the overall variance in the dataset
• prcomp() result doesn’t provide this fraction
• sdev variable returned by prcomp() may be used to first calculate the variance explained by each component by squaring it, then dividing by the sum

library(patchwork)
pca_var <- tibble(
  PC=factor(str_c("PC",1:20),str_c("PC",1:20)),
  Variance=pca$sdev**2,
  `% Explained Variance`=Variance/sum(Variance)*100,
  `Cumulative % Explained Variance`=cumsum(`% Explained Variance`)
)

exp_g <- pca_var %>%
  ggplot(aes(x=PC,y=`% Explained Variance`,group=1)) +
  geom_point() +
  geom_line() +
  theme(axis.text.x=element_text(angle=90,hjust=0,vjust=0.5))

cum_g <- pca_var %>%
  ggplot(aes(x=PC,y=`Cumulative % Explained Variance`,group=1)) +
  geom_point() +
  geom_line() +
  ylim(0,100) + # set y limits to [0,100]
  theme(axis.text.x=element_text(angle=90,hjust=0,vjust=0.5))

exp_g | cum_g

• PCA can help identify outlier samples
• Idea:
  • plot the projections of each sample
  • examine the result by eye to identify samples that are “far away” from the other samples
• No general rules to decide when a sample is an outlier

• PC projects often plotted against each other, e.g. PC1 vs PC2:

as_tibble(pca$x) %>%
  ggplot(aes(x=PC1,y=PC2)) +
  geom_point()

• Can plot all pairs of the first six components using the ggpairs() function in the GGally package

library(GGally)
as_tibble(pca$x) %>%
  dplyr::select(PC1:PC6) %>%
  ggpairs()

• Alternative to scatter plots: beeswarm plot:

library(ggbeeswarm)
as_tibble(pca$x) %>%
  pivot_longer(everything(),names_to="PC",values_to="projection") %>%
  mutate(PC=fct_relevel(PC,str_c("PC",1:20))) %>%
  ggplot(aes(x=PC,y=projection)) +
  geom_beeswarm() + labs(title="PCA Projection Plot")

• Can color our pairwise scatter plot by type like so:

as_tibble(pca$x) %>%
  mutate(type=stringr::str_sub(rownames(pca$x),1,1)) %>%
  ggplot(aes(x=PC1,y=PC2,color=type)) +
  geom_point()

• Can plot pairs of components as before but now with type information

library(GGally)
as_tibble(pca$x) %>%
  mutate(type=stringr::str_sub(rownames(pca$x),1,1)) %>%
  dplyr::select(c(type,PC1:PC6)) %>%
  ggpairs(columns=1:6,mapping=aes(fill=type))

• Heatmaps visualize values associated with a grid of points \((x,y,z)\) as a grid of colored rectangles
• \(x\) and \(y\) define the grid point coordinates and \(z\) is a continuous value
• A common heatmap you might have seen is the weather map, which plots current or predicted weather patterns on top of a geographic map:

• Heatmaps are often used to visualize matrices
• Can create heatmap in R using the base R heatmap() function:
• heatmap() function creates a clustered heatmap where the rows and columns have been hierarchically clustered

# heatmap() requires a R matrix, and cannot accept a tibble or a dataframe
marker_matrix <- as.matrix(
  dplyr::select(ad_metadata,c(tau,abeta,iba1,gfap))
)
# rownames of the matrix become y labels
rownames(marker_matrix) <- ad_metadata$ID

heatmap(marker_matrix)

• Performs hierarchical clustering of the rows and columns using a Euclidean distance function
• Draws dendrograms on the rows and columns
• Scales the data in the rows to have mean zero and standard deviation 1
• Can alter this behavior with arguments:

heatmap(
  marker_matrix,
  Rowv=NA, # don't cluster rows
  Colv=NA, # don't cluster columns
  scale="none", # don't scale rows
)

• The scale mapping \(z\) values to colors is very important when interpreting heatmaps
• heatmap() function has the major drawback that no color key is provided!
• heatmap.2() in gplots package has a similar interface
• Provides more parameters to control the behavior of the plot and includes a color key:

library(gplots)
heatmap.2(marker_matrix)

• Cluster analysis groups similar objects together
• Can identify structure or organization in a dataset
• clustering algorithms have been developed for different situations

• Hierarchical clustering groups data points together in nested, or hierarchical, groups
• Data points are compared for similarity using a distance function
• Two broad strategies:
  • Agglomerative: each datum starts in otart in their own groups, and groups are iteratively merged hierarchically iointsointsnto larger groups data are in a group
  • Divisive: all data points start in the same group, and are recursively split into smaller groups based on their dissimilarity

• Must choose a distance function, e.g \(d(x, y)\)
• \(d(x, y)\) produces a metric with magnitude proportional to difference between \(x\) and \(y\)
• A metric is a non-negative number with no meaningful unit
• Many different metrics, euclidean distance often a reasonable choice

\[d(p, q) = \sqrt{(p - q)^2}\]

• In hierarchical clustering, groups of data are compared to one another
• Linkage function is a distance function for groups of data
• Many choices of linkage function:
  • Single-linkage - distance between two nearest members of the groups
  • Complete-linkage - distance between two farthest members of the groups
  • Unweighted Pair Group Method with Arithmetic mean (UPGMA) - distance is the average distance of all pairs of points between groups
  • Weighted Pair Group Method with Arithmetic mean (WPGMA) - similar to UPGMA, but weights distances from pairs of groups evenly when merging

Below we will cluster the synthetic dataset introduced above in R:

ggplot(well_clustered_data, aes(x=f1,y=f2)) +
  geom_point() +
  labs(title="Unclustered")

# compute all pairwise distances using euclidean distance
# as the distance metric
euc_dist <- dist(dplyr::select(well_clustered_data,-ID))

# produce a clustering of the data using the hclust for
# hierarchical clustering
hc <- hclust(euc_dist, method="ave")

# add ID as labels to the clustering object
hc$labels <- well_clustered_data$ID

str(hc)

## List of 7
##  $ merge      : int [1:59, 1:2] -50 -33 -48 -46 -44 -21 -11 -4 -36 -3 ...
##  $ height     : num [1:59] 0.00429 0.08695 0.23536 0.24789 0.25588 ...
##  $ order      : int [1:60] 8 9 7 6 19 18 11 16 4 14 ...
##  $ labels     : chr [1:60] "A1" "A2" "A3" "A4" ...
##  $ method     : chr "average"
##  $ call       : language hclust(d = euc_dist, method = "ave")
##  $ dist.method: chr "euclidean"
##  - attr(*, "class")= chr "hclust"

• hclust() return object describes the clustering as a tree
• Can visualize using a dendrogram:

library(ggdendro)
ggdendrogram(hc)

• Can split hierarchical clustering into groups based on their pattern
• Can use the cutree to divide the tree into three groups using k=3:

labels <- cutree(hc,k=3)
labels

##  A1  A2  A3  A4  A5  A6  A7  A8  A9 A10 A11 A12 A13 A14 A15 A16 A17 A18 A19 A20 
##   1   1   1   1   1   1   1   1   1   1   1   1   1   1   1   1   1   1   1   1 
##  B1  B2  B3  B4  B5  B6  B7  B8  B9 B10 B11 B12 B13 B14 B15 B16 B17 B18 B19 B20 
##   2   2   2   2   2   2   2   2   2   2   2   2   2   2   2   2   2   2   2   2 
##  C1  C2  C3  C4  C5  C6  C7  C8  C9 C10 C11 C12 C13 C14 C15 C16 C17 C18 C19 C20 
##   3   3   3   3   3   3   3   3   3   3   3   3   3   3   3   3   3   3   3   3

# we turn our labels into a tibble so we can join them with the original tibble
well_clustered_data %>%
  left_join(
    tibble(
      ID=names(labels),
      label=as.factor(labels)
    )
  ) %>%
  ggplot(aes(x=f1,y=f2,color=label)) +
  geom_point() +
  labs(title="Clustered")

## Joining with `by = join_by(ID)`

• data summarization - process of finding a lower-dimensional representation of larger dataset
• A histogram is a summarization:

ggplot(gene_exp, aes(x=`Gene 1`)) +
  geom_histogram(bins=30,fill="#a93c13")

• point estimate: data summarized to a single number
• Represent a data distribution’s central tendency.
• e.g. `

ggplot(gene_exp, aes(x=`Gene 1`)) +
  geom_histogram(bins=30,fill="#a93c13") +
  geom_vline(xintercept=mean(gene_exp$`Gene 1`))

library(patchwork)
well_behaved_data <- tibble(data = rnorm(1000))
# introduce some outliers
data_w_outliers <- tibble(data = c(rnorm(800), rep(5, 200))) 

g_no_outlier <- ggplot(well_behaved_data, aes(x = data)) +
  geom_histogram(fill = "#56CBF9", color = "grey", bins = 30) +
  geom_vline(xintercept = mean(well_behaved_data$data)) +
  ggtitle("Mean example, no outliers")

g_outlier <- ggplot(data_w_outliers, aes(x = data)) +
  geom_histogram(fill = "#7FBEEB", color = "grey", bins = 30) +
  geom_vline(xintercept = mean(data_w_outliers$data)) +
  ggtitle("Mean example, big outliers")

g_no_outlier | g_outlier

g_no_outlier <- ggplot(well_behaved_data, aes(x = data)) +
  geom_histogram(fill = "#AFBED1", color = "grey", bins = 30) +
  geom_vline(xintercept = median(well_behaved_data$data)) +
  ggtitle("Median example")

g_outlier <- ggplot(data_w_outliers, aes(x = data)) +
  geom_histogram(fill = "#7FBEEB", color = "grey", bins = 30) +
  geom_vline(xintercept = median(data_w_outliers$data)) +
  ggtitle("Median example, big outliers")

g_no_outlier | g_outlier

• Dispersion describes the “spread” of the data
• e.g. standard deviation sd()

g1_mean <- mean(gene_exp$`Gene 1`)
g1_sd <- sd(gene_exp$`Gene 1`)
ggplot(gene_exp, aes(x=`Gene 1`)) +
  geom_histogram(bins=30,fill="#a93c13") +
  geom_vline(xintercept=g1_mean) +
  geom_segment(x=g1_mean-g1_sd, y=10, xend=g1_mean+g1_sd, yend=10)

• measure how close values are to the mean

data <- tibble(data = c(rnorm(1000, sd=1.75)))
ggplot(data, aes(x = data)) +
  geom_histogram(fill = "#EAC5D8", color = "white", bins = 30) +
  geom_vline(xintercept = seq(-3,3,1) * sd(data$data)) +
  xlim(c(-6, 6)) +
  ggtitle("Standard deviations aplenty", paste("SD:", sd(data$data)))

• Central tendency and dispersion estimates describe a normal distribution
• Can visually inspect fit of a distribution to data:

g1_mean <- mean(gene_exp$`Gene 1`)
g1_sd <- sd(gene_exp$`Gene 1`)
ggplot(gene_exp, aes(x=`Gene 1`)) +
  geom_histogram(
    aes(y=after_stat(density)),
    bins=30,
    fill="#a93c13"
  ) +
  stat_function(fun=dnorm,
    args = list(mean=g1_mean, sd=g1_sd),
    linewidth=2
  )

• We chose to express the dataset as a normal distribution parameterized by:
  • arithmetic mean - 254
  • standard deviation - 11

\[ Gene\;1 \sim \mathcal{N}(254, 11) \]

g_norm <- ggplot(tibble(data = rnorm(5000)), aes(x = data)) +
  geom_histogram(fill = "#D0FCB3", bins = 50, color = "gray") +
  ggtitle("Normal distribution", "rnorm(n = 1000)")

g_unif <- ggplot(tibble(data = runif(5000)), aes(x = data)) +
  geom_histogram(fill = "#271F30", bins = 50, color = "white") +
  ggtitle("Uniform distribution", "runif(n = 1000)")

g_logistic <- ggplot(tibble(data = rlogis(5000)), aes(x = data)) +
  geom_histogram(fill = "#9BC59D", bins = 50, color = "black") +
  ggtitle("Logistic distribution", "rlogis(n = 1000)")

g_exp <- ggplot(tibble(data = rexp(5000, rate = 1)), aes(x = data)) +
  geom_histogram(fill = "#6C5A49", bins = 50, color = "white") +
  ggtitle("Exponential distribution", "rexp(n = 1000, rate = 1)")

(g_norm | g_unif) / (g_logistic | g_exp)

We chose to model our gene 1 expression data using a normaly distribution parameterized by the arithmetic mean and standard deviation

1. Our model choice was totally subjective
2. We can’t know if this is the “correct” model for the data
3. We don’t know how well our model describes the data yet

• Data distributions are descriptive
• They may not be informative
• Recall one of our scientific questions:
  • If all I know about a patient is their gene expression, how likely is it that they have PD?
• Our model doesn’t answer this question yet

• linear model: any statistical model that relates one outcome variable as a linear combination (i.e. sum) of one or more explanatory variables
• For the mathematically inclined:

\[ Y_i = \beta_0 + \beta_1 \phi_1 ( X_{i1} ) + \beta_2 \phi_2 ( X_{i2} ) + \ldots + \beta_p \phi_p ( X_{ip} ) + \epsilon_i \]

• beeswarm plot plot of Gene 3:

library(ggbeeswarm)
ggplot(gene_exp, aes(x=`Disease Status`, y=`Gene 3`, color=`Disease Status`)) +
  geom_beeswarm()

exp_summ <- pivot_longer( gene_exp, c(`Gene 3`)
  ) %>%
  group_by(`Disease Status`) %>%
  summarize(mean=mean(value),sd=sd(value))

pd_mean <- filter(exp_summ, `Disease Status` == "PD")$mean
c_mean <- filter(exp_summ, `Disease Status` == "Control")$mean

ggplot(gene_exp, aes(x=`Gene 3`, fill=`Disease Status`)) +
  geom_histogram(bins=20, alpha=0.6,position="identity") +
  annotate("segment", x=c_mean, xend=pd_mean, y=20, yend=20,
    arrow=arrow(ends="both", angle=90)) +
  annotate("text", x=mean(c(c_mean,pd_mean)), y=21, hjust=0.5,
    label="How different?")

• make a point estimate of this difference by simply subtracting the means:

pd_mean - c_mean

## [1] 164.0942

In other words, this point estimate suggests that on average Parkinson’s patients have 164.1 greater expression than Controls.

ggplot(gene_exp, aes(x=`Disease Status`, y=`Gene 3`,
                     color=`Disease Status`)) +
  geom_beeswarm() +
  annotate("segment", x=0, xend=3,
           y=2*c_mean-pd_mean, yend=2*pd_mean-c_mean)

• Our difference is an estimate, but how good is it?
• Linear models estimate both the difference and our confidence in that estimate
• Mathematically:
  • \[Gene 3 = \beta_0 + \beta_1*Disease Status\]
• \(\beta_0\) and \(\beta_1\) are called coefficients
  • \(\beta_0\) is our intercept term
  • \(\beta_1\) is our point estimate of difference between PD and Control
• Computing these coefficients is called fitting the model
• This style of analysis is called linear regression

• In R, specify formula like Y ~ X, or Gene 3 ~ Disease Status

fit <- lm(`Gene 3` ~ `Disease Status`, data=gene_exp)
fit

## 
## Call:
## lm(formula = `Gene 3` ~ `Disease Status`, data = gene_exp)
## 
## Coefficients:
##        (Intercept)  `Disease Status`PD  
##              334.6               164.1

summary(fit)

## 
## Call:
## lm(formula = `Gene 3` ~ `Disease Status`, data = gene_exp)
## 
## Residuals:
##      Min       1Q   Median       3Q      Max 
## -124.303  -25.758   -2.434   30.518  119.348 
## 
## Coefficients:
##                    Estimate Std. Error t value Pr(>|t|)    
## (Intercept)         334.578      4.414   75.80   <2e-16 ***
## `Disease Status`PD  164.094      6.243   26.29   <2e-16 ***
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1
## 
## Residual standard error: 44.14 on 198 degrees of freedom
## Multiple R-squared:  0.7773, Adjusted R-squared:  0.7761 
## F-statistic:   691 on 1 and 198 DF,  p-value: < 2.2e-16

# naive solution
fit1 <- lm(`Gene 1` ~ `Disease Status`, data=gene_exp)
fit2 <- lm(`Gene 2` ~ `Disease Status`, data=gene_exp)
fit3 <- lm(`Gene 3` ~ `Disease Status`, data=gene_exp)

gene_stats <- lapply(
  c("Gene 1", "Gene 2", "Gene 3"),
  function(gene) {
    model <- paste0('`',gene,'`',' ~ `Disease Status`')
    fit <- lm(model, data=gene_exp)
    v <- c(gene,
           coefficients(fit),
           summary(fit)$coefficients[2,4]
           )
    names(v) <- c("Gene", "Intercept", "PD", "pvalue")
    return(v)
  }
  ) %>%
  bind_rows() # turn the list into a tibble

# compute FDR from nominal p-values
gene_stats$padj <- p.adjust(gene_stats$pvalue,method="fdr")

gene_stats
## A tibble: 3 × 5
#  Gene   Intercept  PD       pvalue      padj
#  <chr>  <chr>      <chr>    <chr>       <dbl>
#1 Gene 1 250.410    6.959    3.921e-06   3.92e- 6
#2 Gene 2 597.763    -93.629  2.373e-13   3.56e-13
#3 Gene 3 334.577    164.094  1.727e-66   5.18e-66

• Linear regression makes strong assumptions about the distribution of the data
• Generalized linear models that allow these assumptions to be relaxed
• Mathematically, function \(g\) allows different relationships between \(X\) and \(Y\):

\[Y = g^{-1}(\beta_0 + \beta_1 \phi_1 ( X_{i1} ) + \beta_2 \phi_2 ( X_{i2} ) + \ldots + \beta_p \phi_p ( X_{ip} ))\]

• Logistic regression
• Multinomial regression
• Poisson regression
• Negative binomial regression

• High throughput sequencing (HTS) technologies measure and digitize the nucleotide sequences of thousands to billions of DNA molecules simultaneously
• HTS instruments can determine sequence of any DNA molecule in a sample
  
• HTS datasets sometimes called unbiased assays
• Most popular HTS technology today is provided by Illumina biotechnology company

• Illumina sequencing uses biotechnological technique called sequencing by synthesis
• Sequencing instruments are called sequencers
• The process, briefly:
  1. \(10^7\) to \(10^9\) short (~300 nucleotide long) DNA molecules ligated to glass slide
  2. Denatured to become single stranded,
  3. Complementary strand by incorporating fluorescently tagged nucleotides
  4. Tagged nucleotides excited by a laser and photograph taken of slide
  5. Images are processed to reconstruct DNA sequences from fluorescence events

• Any DNA molecules may be subjected to sequencing via this method

• Many different types of experiments are possible:

  • Whole genome sequencing (WGS)
  • RNA Sequencing (RNASeq)
  • Whole genome bisulfite sequencing (WGBS)
  • Chromatin immunoprecipitation followed by sequencing (ChIPSeq)

• Each of these experiments create the same type of data

• Each must be interpreted appropriately based on experiment

• Raw HTS data are the digitized DNA sequences for the billions of molecules captured by the flow cell
• Each digitized nucleotide sequence is called a read
• Data stored in a standardized format called the FASTQ file format

• Data for a single read in FASTQ format:

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

• @ - header, unique read name per flowcell
• GAT... - the nucleotide sequence
• + - second header, usually blank
• !''... - the phred quality scores for each base in the read

• Raw sequencing reads must be processed with bioinformatic algorithms
• Two broad classes of sequence analysis:
  • de novo assembly to recover complete length of original molecules
  • sequence alignment against a set of reference sequences, e.g. genome
• Most data we analyze in R comes from aligned reads that have been produced by other software

• Reads aligned to a reference sequence form a distribution of read counts across all locations in the reference sequence
• Any given reference sequence location, or locus, has zero or more reads that align to it
• The number of reads aligning to a given locus is called the read count
• The read count is proportional to the copy number of molecules in the sample that correspond to that locus
• Read counts from all genes in a reference genome form count data

• The read counts that align to each locus of a genome form a distribution

• Count data have two important properties:

  • Count data are integers
  • Counts are non-negative

• count data are not normally distributed

• Techniques that assume data are normally distributed (like linear regression) are not appropriate for count data

• Must account for this in one of two ways:

  • Use statistical methods that model counts data - generalized linear models that model data using Poisson and Negative Binomial distributions
  • Transform the data to have be normally distributed - certain statistical transformations, such as regularized log or rank transformations can make counts data more closely follow a normal distribution # RNASeq

• RNA sequencing (RNASeq) digitizes the RNA molecules in a sample
• Short reads (~100-300 nucleotides long) represent RNA fragments from longer transcripts
• RNA molecules are (in principle) sequenced in proportion to their relative copy number in the original sample
• Each sequencing dataset has a total number of reads called library size
• Relative copy number means absence of evidence is not evidence of absence
  • i.e. count of zero does not necessarily mean no molecules

• When aligned, reads are counted using a reference annotation that defines locations of genes in the genome
• For a single sample, output is a vector of read counts for each gene in the annotation
• Genes with no reads mapping to them will have a count of zero
• All others will have a read count of one or more;
• Complex multicellular organisms have on the order of thousands to tens of thousands of genes

• Read counts from multiple samples of genes using the same annotation are usually concatenated into a counts matrix
• Counts matrix usually has genes as rows and samples as columns (not tidy!)
• Usually in csv or tsv (tab separated) format
• These counts are from O’Meara et al 2014

counts <- read_tsv("verse_counts.tsv")

counts

## # A tibble: 55,416 × 9
##    gene                  P0_1  P0_2  P4_1  P4_2  P7_1  P7_2  Ad_1  Ad_2
##    <chr>                <dbl> <dbl> <dbl> <dbl> <dbl> <dbl> <dbl> <dbl>
##  1 ENSMUSG00000102693.2     0     0     0     0     0     0     0     0
##  2 ENSMUSG00000064842.3     0     0     0     0     0     0     0     0
##  3 ENSMUSG00000051951.6    19    24    17    17    17    12     7     5
##  4 ENSMUSG00000102851.2     0     0     0     0     1     0     0     0
##  5 ENSMUSG00000103377.2     1     0     0     1     0     1     1     0
##  6 ENSMUSG00000104017.2     0     3     0     0     0     1     0     0
##  7 ENSMUSG00000103025.2     0     0     0     0     0     0     0     0
##  8 ENSMUSG00000089699.2     0     0     0     0     0     0     0     0
##  9 ENSMUSG00000103201.2     0     0     0     0     0     0     0     1
## 10 ENSMUSG00000103147.2     0     0     0     0     0     0     0     0
## # ℹ 55,406 more rows

There are typically three steps when analyzing a RNASeq count matrix:

1. Filter genes that are unlikely to be differentially expressed.
2. Normalize filtered counts to make samples comparable to one another.
3. Differential expression analysis of filtered, normalized counts.

• Genes not detected in any sample (counts are zero) should not be considered
• Genes with very low counts are not likely to be informative
• Eliminating these genes from consideration reduce multiple hypothesis testing burden later
• General approach: set read count criteria to filter out genes

• Genes not detected in any sample should be filtered

nonzero_genes <- rowSums(counts[-1])!=0
filtered_counts <- counts[nonzero_genes,]
slice_head(filtered_counts, n=5)

## # A tibble: 5 × 9
##   gene                  P0_1  P0_2  P4_1  P4_2  P7_1  P7_2  Ad_1  Ad_2
##   <chr>                <dbl> <dbl> <dbl> <dbl> <dbl> <dbl> <dbl> <dbl>
## 1 ENSMUSG00000051951.6    19    24    17    17    17    12     7     5
## 2 ENSMUSG00000102851.2     0     0     0     0     1     0     0     0
## 3 ENSMUSG00000103377.2     1     0     0     1     0     1     1     0
## 4 ENSMUSG00000104017.2     0     3     0     0     0     1     0     0
## 5 ENSMUSG00000103201.2     0     0     0     0     0     0     0     1

• Genes with fewer than 2 reads across all samples filtered

nonzero_genes <- rowSums(counts[-1])>=2
filtered_counts <- counts[nonzero_genes,]
slice_head(filtered_counts, n=5)

## # A tibble: 5 × 9
##   gene                   P0_1  P0_2  P4_1  P4_2  P7_1  P7_2  Ad_1  Ad_2
##   <chr>                 <dbl> <dbl> <dbl> <dbl> <dbl> <dbl> <dbl> <dbl>
## 1 ENSMUSG00000051951.6     19    24    17    17    17    12     7     5
## 2 ENSMUSG00000103377.2      1     0     0     1     0     1     1     0
## 3 ENSMUSG00000104017.2      0     3     0     0     0     1     0     0
## 4 ENSMUSG00000102331.2      5     8     2     6     6    11     4     3
## 5 ENSMUSG00000025900.14     4     3     6     7     7     3    36    35

• Statistical procedures don’t work with too many zeros
• Small read counts may indicate very lowly abundant but biologically relevant genes
• Can filter genes based on number of non-zero sample counts
  • e.g. Filter out genes if they have zero counts in more than half of samples

• Consider genes present in at least \(n\) samples
• Plots distribution of mean counts within each number of nonzero samples:

• In counts data, genes with higher mean count also have higher variance
• Mean-variance dependence means these count data are heteroskedastic

• Genes with very few counts do not enable reliable statistical inference
• There is no biological meaning to any filtering threshold
• The read counts for a gene depends upon the total number of reads generated
• We cannot use filtering to “remove lowly expressed genes”
• Can only filter out genes that are below the detection threshold afforded by the library size of the dataset

• The range of gene expression in a cell varies by orders of magnitude
• Consider the distribution of read counts on a log10 scale from one sample

dplyr::select(filtered_counts, Ad_1) %>%
  filter(Ad_1 > 0) %>% # avoid taking log10(0)
  mutate(`log10(counts)`=log10(Ad_1)) %>%
  ggplot(aes(x=`log10(counts+1)`)) +
  geom_histogram(bins=50) +
  labs(title='log10(counts) distribution for Adult mouse')

• Consider distribution for all the samples as a ridgeline plot

• Every sample will have a different number of reads (library size)
• The number of reads that maps to any given gene is dependent upon:
  • the relative abundance of the molecule in the sample
  • the library size of each sample
• The raw read counts are not directly comparable between samples
• Counts in each sample must be normalized so they are comparable

• Count normalization: the process by which the number of raw counts in each sample is scaled by a factor to make multiple samples comparable
• Many strategies have been proposed to do this
• The simplest is: divide ever count by some factor of the library size
  • e.g. compute counts per million reads or CPM normalization

\[ cpm_{s,i} = \frac{c_{s,i}}{l_s} * 10^6 \]

\[ cpm_{s,i} = \frac{c_{s,i}}{l_s} * 10^6 \] * \(c_{s,i} =\) raw count of gene \(i\) in sample \(s\) * \(l_s =\) library size for sample \(s\) * In principle, the proportion of read counts for each gene will be comparable between samples

• CPM is a library size normalization
• Library size normalizations are sensitive to extreme outlier genes
  • e.g. if one gene in one sample has abnormally large counts, this can cause other gene counts to be smaller than they truly are
• These outlier counts are common in RNASeq data!
• Normalization method should be robust to these outliers

• DESeq2 bioconductor package introduced a robust normalization method
• Assumes that most genes are not differentially expressed
• Uses the median geometric mean computed across all samples to determine the scale factor for each sample
• Currently the de facto standard normalization method for well characterized genomes

library(DESeq2)
# DESeq2 requires a counts matrix
# column data (sample information), and a formula
# the counts matrix *must be raw counts*
count_mat <- as.matrix(filtered_counts[-1])

row.names(count_mat) <- filtered_counts$gene

dds <- DESeqDataSetFromMatrix(
  countData=count_mat,
  colData=tibble(sample_name=colnames(filtered_counts[-1])),
  design=~1 # no formula needed, ~1 produces a trivial design matrix
)

# compute normalization factors
dds <- estimateSizeFactors(dds)

# extract the normalized counts
deseq_norm_counts <- as_tibble(counts(dds,normalized=TRUE)) %>%
  mutate(gene=filtered_counts$gene) %>%
  relocate(gene) # relocate changes column order

The DESeq2 normalization procedure has two important considerations:

• The procedure borrows information across all samples.
• The procedure does not use genes with any zero counts.

The CPM normalization procedure does not borrow information across all samples, and therefore is not subject to these considerations.

• One way to deal with the non-normality of count data is transform it to follow a normal distribution
• Enables more statistical methods like linear regression to be used
• Count data are roughly log-normal, however low and zero counts can be problematic for traditional log()
• The DESeq2 package provides the rlog() function that performs a regularized logarithmic transformation that avoids these biases

# the dds is the DESeq2 object from earlier
rld <- rlog(dds)

# Differential Expression Analysis

• Goal: identify to what extent gene expression is associated with one or more variables of interest
• Typically analyze whole transcriptome (i.e. 1000s of genes)
• Two required components:
  • an expression matrix (e.g. genes x samples)
  • a design matrix

• A design matrix is a numeric matrix that contains
  • the variables we wish to model
  • any covariates or confounders we wish to adjust for
• Encoded in a way that statistical procedures understand
• Construct these matrices from a tibble with the model.matrix() function

ad_metadata 

## # A tibble: 6 × 8
##   ID    age_at_death condition   tau  abeta   iba1   gfap braak_stage
##   <chr>        <dbl> <fct>     <dbl>  <dbl>  <dbl>  <dbl> <fct>      
## 1 A1              73 AD        96548 176324 157501  78139 4          
## 2 A2              82 AD        95251      0 147637  79348 4          
## 3 A3              82 AD        40287  45365  17655 127131 2          
## 4 C1              80 Control   62684  93739 131595 124075 3          
## 5 C2              77 Control   63598  69838   7189  35597 3          
## 6 C3              72 Control   52951  19444  54673  17221 2

• Model matrix to identify genes that are increased or decreased in people with AD compared with Controls
• The ~ condition argument is an an R formula

model.matrix(~ condition, data=ad_metadata)

model.matrix(~ condition, data=ad_metadata)

##   (Intercept) conditionAD
## 1           1           1
## 2           1           1
## 3           1           1
## 4           1           0
## 5           1           0
## 6           1           0
## attr(,"assign")
## [1] 0 1
## attr(,"contrasts")
## attr(,"contrasts")$condition
## [1] "contr.treatment"

The general format of a formula is as follows:

# portions in [] are optional
[<outcome variable>] ~ <predictor 1> [+ <predictor 2>]...

# examples

# model Gene 3 expression as a function of disease status
`Gene 3` ~ condition

# model the amount of tau pathology as a function of abeta pathology,
# adjusting for age at death
tau ~ age_at_death + abeta

# can create a model without an outcome variable
~ age_at_death + condition

• Can include other variables in model to adjust for covariates or test other contrasts
• e.g. adjust out the effect of age by including age_at_death as a covariate in the model:

model.matrix(~ age_at_death + condition, data=ad_metadata)

model.matrix(~ age_at_death + condition, data=ad_metadata)

##   (Intercept) age_at_death conditionAD
## 1           1           73           1
## 2           1           82           1
## 3           1           82           1
## 4           1           80           0
## 5           1           77           0
## 6           1           72           0
## attr(,"assign")
## [1] 0 1 2
## attr(,"contrasts")
## attr(,"contrasts")$condition
## [1] "contr.treatment"

• limma: linear models of microarrays
• Designed for analyzing microarray gene expression data
• One of the top most downloaded Bioconductor packages
• Supports arbitrarily complex experimental designs while maintaining strong statistical power
• Can perform reliable inference even with small sample sizes

• limma requires:
  • ExpressionSet or SummarizedExperiment container
  • a design matrix

ad_se  <- SummarizedExperiment(
  assays=list(intensities=intensities),
  colData=ad_metadata,
  rowData=rownames(intensities)
)

# design matrix for AD vs control, adjusting for age at death
ad_vs_control_model <- model.matrix(
  ~ age_at_death + condition,
  data=ad_metadata
)

# now run limma
# first fit all genes with the model
fit <- limma::lmFit(
  assays(se)$intensities,
  ad_vs_control_model
)

# now better control fit errors with the empirical Bayes method
fit <- limma::eBayes(fit)

• Look at top results using limma::topTable() function:

# the coefficient name conditionAD is the column name in the design matrix
topTable(fit, coef="conditionAD", adjust="BH", number=5)

##                  logFC  AveExpr         t      P.Value adj.P.Val         B
## 206354_at   -2.7507429 5.669691 -5.349105 3.436185e-05 0.9992944 -2.387433
## 234942_s_at  0.9906708 8.397425  5.206286 4.726372e-05 0.9992944 -2.447456
## 243618_s_at -0.6879431 7.148455 -4.864695 1.020980e-04 0.9992944 -2.598600
## 223703_at    0.8693657 6.154392  4.745033 1.340200e-04 0.9992944 -2.654092
## 244391_at   -0.5251423 5.532712 -4.691482 1.514215e-04 0.9992944 -2.679354

• Normalized read counts are suitable for differential expression
• Counts matrix created by concatenating read counts for all genes rows are genes or transcripts and columns are samples
• Read counts not normally distributed, requires statistical approach that either
  1. Models counts explicitly
  2. Transform counts to be normally distributed, use common statistical methods

• Poisson distribution: expresses probability that a given number of events occur in a fixed period, e.g. time, space, distance, area, volume
• Can model number of reads aligning to a given genome position/locus
• Whole Genome Sequencing (WGS) data are modeled this way

\[ f(k;\lambda) = \mathtt{Pr}(X=k) = \frac{\lambda^k e^{-\lambda}}{k!} \]

• \(\lambda\) is the average number of events observed in each period

\[ \lambda = \mathtt{E}(X) = \mathtt{Var}(X) \]

• In Poisson, the mean and variance are assumed to be equal

• In counts data, genes with higher mean count also have higher variance

• In a set of Bernoulli trials, models the number of failures before a specified number of successes occurs

\[ f(k; r,p) = \mathtt{Pr}(X=k) = \binom{k+r-1}{k} (1-p)^k p^r \]

• \(r\) - number of “successes”, \(p\) - probability of success
• Alternate formulation:

\[ p = \frac{\mu}{\sigma^2}, r = \frac{\mu^2}{\sigma^2 - \mu} \]

• Index of dispersion \(D\)

\[ D = \frac{\sigma^2}{\mu} \]

• DESeq2 and edgeR are bioconductor packages that both implement negative binomial regression for RNASeq data
• Both perform raw counts normalization
  • DESeq2 - described earlier
  • edgeR - trimmed mean of M-values (TMM)

As mentioned briefly above, DESeq2 requires three pieces of information to perform differential expression:

1. A raw counts matrix with genes as rows and samples as columns
2. A data frame with metadata associated with the columns
3. A design formula for the differential expression model

library(DESeq2)

# the counts matrix *must be raw counts*
count_mat <- as.matrix(filtered_counts[-1])
row.names(count_mat) <- filtered_counts$gene

# create a sample matrix from sample names
sample_info <- tibblesample_name=colnames(filtered_counts[-1])) %>%
  separate(sample_name,
    c("timepoint","replicate"),sep="_",remove=FALSE
  ) %>%
  mutate(
    timepoint=factor(timepoint,levels=c("Ad","P0","P4","P7"))
  )

design <- formula(~ timepoint)

sample_info

## # A tibble: 8 × 3
##   sample_name timepoint replicate
##   <chr>       <fct>     <chr>    
## 1 P0_1        P0        1        
## 2 P0_2        P0        2        
## 3 P4_1        P4        1        
## 4 P4_2        P4        2        
## 5 P7_1        P7        1        
## 6 P7_2        P7        2        
## 7 Ad_1        Ad        1        
## 8 Ad_2        Ad        2

dds <- DESeqDataSetFromMatrix(
  countData=count_mat,
  colData=sample_info,
  design=design
)
dds <- DESeq(dds)
resultsNames(dds)

## [1] "Intercept"          "timepoint_P0_vs_Ad" "timepoint_P4_vs_Ad"
## [4] "timepoint_P7_vs_Ad"

res <- results(dds, name="timepoint_P0_vs_Ad")
p0_vs_Ad_de <- as_tibble(res) %>%
  mutate(gene=rownames(res)) %>%
  relocate(gene) %>%
  arrange(pvalue)
head(p0_vs_Ad_de, 5)

## # A tibble: 5 × 7
##   gene                  baseMean log2FoldChange lfcSE  stat    pvalue      padj
##   <chr>                    <dbl>          <dbl> <dbl> <dbl>     <dbl>     <dbl>
## 1 ENSMUSG00000000031.17   19624.           6.75 0.187  36.2 2.79e-286 5.43e-282
## 2 ENSMUSG00000026418.17    9671.           9.84 0.283  34.7 2.91e-264 2.83e-260
## 3 ENSMUSG00000051855.16    3462.           5.35 0.155  34.5 4.27e-261 2.76e-257
## 4 ENSMUSG00000027750.17    9482.           4.05 0.123  33.1 1.23e-239 5.98e-236
## 5 ENSMUSG00000042828.13    3906.          -5.32 0.165 -32.2 3.98e-227 1.55e-223

• baseMean - the mean normalized count of all samples for the gene
• log2FoldChange - the estimated coefficient (i.e. log2FoldChange) for the comparison of interest
• lfcSE - the standard error for the log2FoldChange estimate
• stat - the Wald statistic associated with the log2FoldChange estimate
• pvalue - the nominal p-value of the Wald test (i.e. the signifiance of the association)
• padj - the multiple testing adjusted p-value (i.e. false discovery rate)

# number of genes significant at FDR < 0.05
filter(p0_vs_Ad_de,padj<0.05)

## # A tibble: 7,467 × 7
##    gene                  baseMean log2FoldChange lfcSE  stat    pvalue      padj
##    <chr>                    <dbl>          <dbl> <dbl> <dbl>     <dbl>     <dbl>
##  1 ENSMUSG00000000031.17   19624.           6.75 0.187  36.2 2.79e-286 5.43e-282
##  2 ENSMUSG00000026418.17    9671.           9.84 0.283  34.7 2.91e-264 2.83e-260
##  3 ENSMUSG00000051855.16    3462.           5.35 0.155  34.5 4.27e-261 2.76e-257
##  4 ENSMUSG00000027750.17    9482.           4.05 0.123  33.1 1.23e-239 5.98e-236
##  5 ENSMUSG00000042828.13    3906.          -5.32 0.165 -32.2 3.98e-227 1.55e-223
##  6 ENSMUSG00000046598.16    1154.          -6.08 0.197 -30.9 5.77e-210 1.87e-206
##  7 ENSMUSG00000019817.19    1952.           5.15 0.170  30.3 1.14e-201 3.18e-198
##  8 ENSMUSG00000021622.4    17146.          -4.57 0.155 -29.5 5.56e-191 1.35e-187
##  9 ENSMUSG00000002500.16    2121.          -6.20 0.216 -28.7 2.36e-181 5.10e-178
## 10 ENSMUSG00000024598.10    1885.           5.90 0.208  28.4 1.46e-177 2.83e-174
## # ℹ 7,457 more rows

• Volcano plots are log2 fold change vs -log10(p-value)

mutate(
  p0_vs_Ad_de,
  `-log10(adjusted p)`=-log10(padj),
  `FDR<0.05`=padj<0.05
  ) %>%
  ggplot(aes(x=log2FoldChange,y=`-log10(adjusted p)`,color=`FDR<0.05`)) +
  geom_point()

## Warning: Removed 9551 rows containing missing values or values outside the scale range
## (`geom_point()`).

• limma package (for microarrays) was extended to support RNASeq
• Transforms count with voom transformation
  1. Compute CPM
  2. Take log of CPM
  3. Estimate mean-variance relationship to control errors
• Uses linear model on transformed counts

• Brief example is from the limma User Guide chapter 15

design <- data.frame(swirl = c("swirl.1", "swirl.2", "swirl.3", "swirl.4"),
                     condition = c(1, -1, 1, -1))
dge <- DGEList(counts=counts)
keep <- filterByExpr(dge, design)
dge <- dge[keep,,keep.lib.sizes=FALSE]

• Use topTable() as in microarray limma results:

# limma trend
logCPM <- cpm(dge, log=TRUE, prior.count=3)
fit <- lmFit(logCPM, design)
fit <- eBayes(fit, trend=TRUE)
topTable(fit, coef=ncol(design))

• Individual gene studies can characterize:
  • function
  • localization
  • structure
  • interactions
  • chemical properties
  • dynamics
• Genes are annotated with these properties via different databases
• Some annotations consolidated into centralized metadatabases
• e.g. genecards.org

* https://www.genecards.org/cgi-bin/carddisp.pl?gene=APOE&keywords=APOE

• Ontology: a controlled vocabulary of biological concepts
• The Gene Ontology (GO): a set of terms that describes what genes are, do, etc
• Each GO Term has a code like GO:NNNNNNN, e.g. GO:0019319
• GO Terms subdivided into three namespaces:
  • Biological Process (BP) - pathways, etc
  • Molecular Function (MF) - enzymatic activity, DNA binding, etc
  • Cellular Component (CC) - nucleus, cell membrane, etc
• Terms within each namespace are hierarchical, form a directed acyclic graph (DAG)

• http://amigo.geneontology.org/amigo/term/GO:0019319

• GO Terms can apply to genes from all biological systems
• The GO itself does not contain gene annotations
• GO annotations are provided/maintained separately for each organism
• A gene may be annotated to many GO terms
• A GO term may be annotated to many genes

• High throughput gene expression studies implicate many genes
• What biological processes are implicated by a differential expression analysis?
• Idea: examine the annotations of all implicated genes and look for patterns

• Genes can be organized by different attributes:
  • biochemical function, e.g. enzymatic activity
  • biological process, e.g. pathways
  • localization, e.g. nucleus
  • disease association
  • chromosomal locus
  • defined by differential expression studies!
  • any other reasonable grouping
• A gene set is a group of genes related in one way or another
• e.g. all genes annotated to GO Term GO:0019319 - hexose biosynthetic process

• Gene set database: a collection of gene sets
• Different databases organize/maintain different sets of genes for different purposes

• Available at geneontology.org for many species
• Programmatic access as well
• Provided in tab-delimited GAF (GO Annotation Format) files

• Kyoto Encyclopedia of Genes and Genomcs
• “Gold standard” for curated pathways
• Highly detailed, validated gene sets with gene interaction information
• https://www.genome.jp/kegg/pathway.html

• Molecular Signatures Data Base
• Originally, gene sets associated with cancer
• Contains 9 collections of gene sets:
  • H - well defined biological states/processes
  • C1 - positional gene sets
  • C2 - curated gene sets
  • C3 - regulatory targets
  • C4 - computational gene sets
  • C5 - GO annotations
  • C6 - oncogenic signatures
  • C7 - immunologic signatures
  • C8 - cell type signatures

• .gmt - Gene Matrix Transpose
• Defined by Broad Institute for use in its GSEA software
• Contains gene sets, one per line
• Tab-separated format with columns:
  • 1st column: Gene set name
  • 2nd column: Gene set description (often blank)
  • 3rd and on: gene identifiers for genes in set

library('GSEABase')
hallmarks_gmt <- getGmt(con='h.all.v7.5.1.symbols.gmt')
hallmarks_gmt
## GeneSetCollection
##   names: HALLMARK_TNFA_SIGNALING_VIA_NFKB, HALLMARK_HYPOXIA, ..., HALLMARK_PANCREAS_BETA_CELLS (50 total)
##   unique identifiers: JUNB, CXCL2, ..., SRP14 (4383 total)
##   types in collection:
##     geneIdType: NullIdentifier (1 total)
##     collectionType: NullCollection (1 total)

• Compare
  • a gene list of interest (e.g. DE gene list) with
  • a gene set (e.g. genes annotated to GO:0019319)
• Are the genes in our gene list have more similarity to the genes in the gene set than we expect by chance?

• Over-representation: does our gene list overlap a gene set more than expected by chance?
• Rank-based: are the gene in a gene set more increased/decreased in our gene list than expected by chance?

• Useful with a list of “genes of interest” e.g. DE genes at FDR < 0.05
• Compute overlap with genes in a gene set
• Is the overlap greater than we would expect by chance?

contingency_table <- matrix(c(13, 987, 23, 8977), 2, 2)
fisher_results <- fisher.test(contingency_table, alternative='greater')
fisher_results
## 
##  Fisher's Exact Test for Count Data
## 
## data:  contingency_table
## p-value = 2.382e-05
## alternative hypothesis: true odds ratio is greater than 1
## 95 percent confidence interval:
##  2.685749      Inf
## sample estimates:
## odds ratio 
##   5.139308

• Inputs:
  • all genes irrespective of significance, ranked by a statistic e.g. log2 fold change
  • gene set database
• Examines whether genes in each gene set are more highly or lowly ranked than expected by chance
• Computes a Kolmogorov-Smirnov test to determine signficance
• Produces Normalized Enrichment Score
  • Positive if gene set genes are at the top of the sorted list
  • Negative if at bottom
• Official software: standalone JAVA package

• fgsea package implements the GSEA preranked algorithm in R
• Requires
  • List of ranked genes
  • Database of gene sets